Chromosome walking

From The School of Biomedical Sciences Wiki
Revision as of 06:19, 24 November 2015 by Nnjm2 (Talk | contribs)
(diff) ← Older revision | Latest revision (diff) | Newer revision → (diff)
Jump to: navigation, search

Chromosome walking is technique that can be used to construct a clone contig by identifying overlapping fragments of cloned DNA.[1] This method is mainly used when sequence of gene is known but no clone gene avaliable. 

Example:

ATCGTAGCTAGCGATTTC
                             ATTTCGATTATCGATTTCGATGCTA
                                                               CGATGCTAGCCGATTTAGCTAGC
                                                                                              TTAGCTAGCTACGCGATCGATCGAGAGAG
  
ATCGTAGCTAGCG ATTTC GATTATCGATTT CGATGCTA GCCGAT TTAGCTAGC TACGCGATCGATCGAGAGAG
 

Reference: 

  1. http://www.ncbi.nlm.nih.gov/books/NBK21117/
Personal tools
Namespaces
Variants
Actions
Navigation
Toolbox